ATAA

AcronymDefinition
ATAAAlternative Trade Adjustment Assistance
ATAAAustralian Technical Analysts Association (Eastlakes, New South Wales, Australia)
ATAAAir Transport Association of America
ATAAAssociation des Traducteurs/Adaptateurs de l'Audiovisuel (French)
ATAAAny Time At All (Beatles song)
ATAAAkhal-Teke Association of America, Inc.
Copyright 1988-2018 AcronymFinder.com, All rights reserved.
References in periodicals archive ?
Since the creation of the chiefdoms and upgrade of Ujah of Anaguta and Ataa Aten of Ganawuri to first class status tongues have been set waging on the motive behind the exercise until the recent circular from the Ministry of Local Government and Chieftaincy Affairs which pronounced the establishment of separate traditional council for the two first class traditional rulers.
During the Saka Acquaye era, all the dramas and films were then in English, a situation that inspired the late Ataa Mensah to change the phase of the industry by acting in Ga.
The first match saw Al Ataa and Al Quwah share the spoils in a six-goal thriller in Group 1.
Be-cause PNN has the advantages of low training complexity, high stability, quick convergence, and simple construction, it has a wide range of application in model classification, identification, prediction, as well as fault diagnosis and other fields(Adeli and Panakkat, 2009; Song et al., 2007; Ataa et al., 2017; Rutkowski, 2004 ).
Summary: DHA launches Ataa' wa Saa'da (Giving and Happiness) initiative
Ataa, Effect of Tetravalent Titanium Ions Substitution on the Dielectric Properties of Co-Zn Ferrites, J.
In partnership with the Municipality of Tripoli, the Ahal El Ataa Scouts, LaVajet Cleaning Company, the Development for People and Nature Association (DPNA) and Utopia, the cleaning event aimed to spread awareness about the importance of managing solid waste through community action.
Al Rahma and Dara Al Ataa charitable organisations were instrumental to ensuring food supplies provided under the campaign reached deserving families, often distributed by the bank's own employees.
Allah says, "and no (Jidal) disputing during Haj." (Qur'an, 2:197) Ataa said, Al-Jidal is that you dispute your companion until you anger him and he angers you.
Ataa Muhammad, Director General Local Government and Community Development Shahid Nasar Raja, Director Community Development and Training Najeeb Aalam, SSP Special Branch Syed Bahar Ahmed Shah, Superintending Engineers Shafaqat Hussain, Sheikh Fazal Karim, ACG Muhammad Asad, ACR Saif ur Rehman, Director Health Services Dr.
Primers and probes used in real-time PCR for Ehrlichia and Anaplasma species, United States * Name Sequence, 5' [right arrow] 3' Primer 1 GCATTACTCACCCGTCTGCCACT Primer 2 CAAGCCTAACACATGCAAGTCGAACG Probe 1 MGB-FAM-AGGT ([dagger]) T ([dagger]) ATAA ([dagger]) GCA ([dagger]) ATTGTCC-EDQ Probe 2 MGB-(AP642)-AAGCTATA ([dagger]) GGCA ([dagger]) GT ([dagger]) TA ([dagger]) TCC-EDQ Probe 3 MGB-(AP593)-GGCTATA ([dagger]) A ([dagger]) ATA ([dagger]) A ([dagger]) TTGT ([dagger]) CCG-EDQ Probe 4 MGB-(AP593)-CTATTTA ([dagger]) GGA ([dagger]) A ([dagger]) TTGT ([dagger]) T ([dagger]) C-EDQ Probe 5 MGB-(AP525)-AAAGAAT ([dagger]) A ([dagger]) A ([dagger]) TCCGTTCG-EDQ Name Concentration, Species detected nmol/L Primer 1 250 - Primer 2 1,000 - Probe 1 200 E.